Sequence ID | >WENV170646147 |
Genome ID | JQGG01001206 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 1233 |
End posion on genome | 1158 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
acggatccgc |
tRNA gene sequence |
GTCCCCATCGTCTAGAGGCCTAGGACACAACCCTTTCACGGTTGCGACCGGGGTTCGAAT |
Downstream region at tRNA end position |
tacaaggccg |
Secondary structure (Cloverleaf model) | >WENV170646147 Glu TTC c GCCA tacaaggccg G - C T - A C - G C - G C - G C - G A - T T A T G C C C C A A G A C | | | | | G G T C T G C G G G G C G + | | | T T C G G A C C T A A CGAC C - G A - T A - T C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |