Sequence ID | >WENV170646149 |
Genome ID | JQGG01001430 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 97 |
End posion on genome | 189 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ttcgcctcac |
tRNA gene sequence |
GGAGACTTGCCCGAGAGGCCGAAGGGGCTCCCCTGCTAAGGGAGTATAGGGTCAAAAGCT |
Downstream region at tRNA end position |
cttgcggcga |
Secondary structure (Cloverleaf model) | >WENV170646149 Ser GCT c GCCA cttgcggcga G - C G - C A - T G - C A - T C - G T - A T A T C T C C C A A G A G | | | | | G G G C C C G A G G G C G | | | T T C A G G G C G A G TATAGGGTCAAAAGCTCTATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |