Sequence ID | >WENV170646153 |
Genome ID | JQGG01001820 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 549 |
End posion on genome | 474 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
cccgtacaac |
tRNA gene sequence |
GGGGCCTTAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGTCATCGGTTCGATC |
Downstream region at tRNA end position |
gctacgacga |
Secondary structure (Cloverleaf model) | >WENV170646153 Ala TGC c ACCA gctacgacga G - C G - C G + T G - C C - G C - G T - A C T T T A G C C A C G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |