Sequence ID | >WENV170646157 |
Genome ID | JQGG01003142 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 89 |
End posion on genome | 164 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
aggtttgacg |
tRNA gene sequence |
GCCCACGTAGCTCAGTCGGTAGAGCACGTCCTTGGTAAGGACGAGGTCACCGGTTCGATT |
Downstream region at tRNA end position |
gagtttgagg |
Secondary structure (Cloverleaf model) | >WENV170646157 Thr GGT g TCCA gagtttgagg G - C C - G C - G C - G A - T C - G G - C T T T T G G C C A T G A A | | | | | G C C T C G A C C G G C G | | | | T T G G A G C T A A AGGTC C - G G - C T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |