Sequence ID | >WENV170646161 |
Genome ID | JQGG01003673 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 428 |
End posion on genome | 353 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gtagaaatac |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCAACGGTTCGATC |
Downstream region at tRNA end position |
aactcatcga |
Secondary structure (Cloverleaf model) | >WENV170646161 Ala TGC c ACCA aactcatcga G - C G - C G + T G - C C - G C A A - T C T T T T G C C A C G A A | | | | | G T C T C G A A C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |