Sequence ID | >WENV170646163 |
Genome ID | JQGG01004303 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 211 |
End posion on genome | 138 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ctaaccctat |
tRNA gene sequence |
TGGGGGATCGTCTAGCGGTAGGACTACGGACTCTGACTCCGTCAACCTAGGTTCGAATCC |
Downstream region at tRNA end position |
acttgcagcg |
Secondary structure (Cloverleaf model) | >WENV170646163 Gln CTG t GCCA acttgcagcg T - A G - C G - C G - C G - C G - C A - T T A T G A T C C A G A C | | | | | G C T C T G C T A G G C G + | | | T T G G G A C T A T CAAC A - T C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |