Sequence ID | >WENV170646166 |
Genome ID | JQGG01010286 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 380 |
End posion on genome | 466 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgtgtcaggc |
tRNA gene sequence |
GCGCGGGTGGCGAAATTGGTAGACGCACCAGGTTTAGGTCCTGACGCCAGCAATGGTGTG |
Downstream region at tRNA end position |
cagcaccgac |
Secondary structure (Cloverleaf model) | >WENV170646166 Leu TAG c ACCA cagcaccgac G - C C - G G - C C - G G - C G - C G - C T G T C C C C C A T A A G | | | | | G T A G C G G G G G G C G | | | T T G A C G C T A G A CGCCAGCAATGGTGT C A C - G A - T G - C G - C T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |