Sequence ID | >WENV170646167 |
Genome ID | JQGG01010633 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 184 |
End posion on genome | 92 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gctgcgatcc |
tRNA gene sequence |
GGAGACGTGGGTGAGTGGCTGAAACCAACGGTTTGCTAAACCGTCGTACTGGTAAATCCG |
Downstream region at tRNA end position |
aaataaagca |
Secondary structure (Cloverleaf model) | >WENV170646167 Ser GCT c GCCA aaataaagca G - C G - C A - T G + T A C C C G - C T A T C T C C C A T G A G | | | | | G G G T G G G A G G G C G | | | T T C A A C C T G A A CGTACTGGTAAATCCGGTACC A - T C - G G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |