Sequence ID | >WENV170646168 |
Genome ID | JQGG01011146 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 181 |
End posion on genome | 105 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ggagctccga |
tRNA gene sequence |
CGGGGTGTAGCGCAGTTGGTCAGCGCGCATGGTTTGGGACCATGAGGTCGCCGGTTCGAA |
Downstream region at tRNA end position |
catagcgcct |
Secondary structure (Cloverleaf model) | >WENV170646168 Pro TGG a ACCG catagcgcct C - G G - C G - C G - C G - C T - A G - C T A T C G G C C A T G A A | | | | | G T C G C G G C C G G C G | | | | T T G G C G C T C A G AGGTC C - G A - T T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |