Sequence ID | >WENV170646171 |
Genome ID | JQGG01012425 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 518 |
End posion on genome | 442 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
agtgtcaaaT |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGAGGTCAGGAGTTCGACT |
Downstream region at tRNA end position |
tcacatcgcg |
Secondary structure (Cloverleaf model) | >WENV170646171 Ala TGC T ACCA tcacatcgcg G - C G - C G + T G - C C T C - G A A T C T T C C T C A C G A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G T C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |