Sequence ID | >WENV170646172 |
Genome ID | JQGG01012562 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 161 |
End posion on genome | 87 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tgagtcattt |
tRNA gene sequence |
GCGGGATTCGTATAACGGCTAATATATCAGTTTTCCAAACTGAGGACACCGGTTCGATTC |
Downstream region at tRNA end position |
tgtagctctc |
Secondary structure (Cloverleaf model) | >WENV170646172 Gly TCC t ACCA tgtagctctc G - C C - G G - C G - C G - C A - T T - A T T T T G G C C A C A A C | | | | | G G T A T G A C C G G C G | | | + T T C A T A T T A A GGAC T - A C - G A - T G - C T - A T A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |