Sequence ID | >WENV170646173 |
Genome ID | JQGG01013394 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 206 |
End posion on genome | 133 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ttgcccgcac |
tRNA gene sequence |
TGGGGCATGGTGCAACGGCAGCACACCAGCCTTTGGAGCTGTGGATCTTGGTTCGAGTCC |
Downstream region at tRNA end position |
cactttcccg |
Secondary structure (Cloverleaf model) | >WENV170646173 Gln TTG c GCCA cactttcccg T - A G - C G - C G - C G - C C - G A - T T G T G G A C C A A A G | + | | | G C C G T G C T T G G C G | | | | T T G G C A C C A A GGAT C T C - G A - T G - C C - G C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |