Sequence ID | >WENV170646174 |
Genome ID | JQGG01013476 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 161 |
End posion on genome | 86 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aagcaggtac |
tRNA gene sequence |
GGGCCTGTAGCTCAGTGGTTAGAGCTGGCCGCTCATAACGGCTAGGTCGCAGGTTCGAAT |
Downstream region at tRNA end position |
ccgcgcggcg |
Secondary structure (Cloverleaf model) | >WENV170646174 Met CAT c ACCA ccgcgcggcg G - C G - C G - C C - G C - G T + G G - C T A T C G T C C A T G A A | | | | | G G C T C G G C A G G C G | | | | T T T G A G C T A T AGGTC G + T G - C C - G C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |