Sequence ID | >WENV170646179 |
Genome ID | JQGG01014473 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 248 |
End posion on genome | 174 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cgaatggtgc |
tRNA gene sequence |
GGGCGTATAGCTCAGTGGTAGAGCACTATGTTGACATCGTAGGGGTCGCAAGTTCAATCC |
Downstream region at tRNA end position |
ttcgctgaaa |
Secondary structure (Cloverleaf model) | >WENV170646179 Val GAC c ACCA ttcgctgaaa G - C G - C G - C C - G G - C T - A A - T C T T C G T T C A G A A | | | | | A T C T C G G C A A G C G | | | | T T G G A G C T A A GGGTC C - G T - A A - T T + G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |