Sequence ID | >WENV170646180 |
Genome ID | JQGG01014615 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 241 |
End posion on genome | 168 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
caaggttcgg |
tRNA gene sequence |
GCGGGCTTAGCATAGTGGTAATGCCCTGGCTTCCCAAGCCAGTTAGACGGGTTCGATCCC |
Downstream region at tRNA end position |
tcaccctccg |
Secondary structure (Cloverleaf model) | >WENV170646180 Gly CCC g TCCA tcaccctccg G - C C - G G - C G - C G - C C - G T - A C T T T G C C C A G A A | | | | | G T T A C G A C G G G C G | | | | T T G A T G C T A C TTAG C - G T - A G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |