Sequence ID | >WENV170646182 |
Genome ID | JQGG01018074 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 378 |
End posion on genome | 304 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
gtaaccgtct |
tRNA gene sequence |
GGGGAGTTAGTTCAGCTGGTTAGAACGCCGGCCTGTCACGCCGGAGGTCAGGGGTTCAAG |
Downstream region at tRNA end position |
aaaatcgacc |
Secondary structure (Cloverleaf model) | >WENV170646182 Asp GTC t GCag aaaatcgacc G - C G + T G - C G - C A - T G - C T - A T G T T C C C C A C G A A | | | | | A T C T T G A G G G G C G | | | | T T G G A A C T T A G AGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |