Sequence ID | >WENV170646183 |
Genome ID | JQGG01018787 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 144 |
End posion on genome | 218 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
agcctgcgcT |
tRNA gene sequence |
GGGGCCATAGGGTAGCCTGGTATCCTACAGGACTGGGGGTCCTGTGACCGGCGTTCAAAT |
Downstream region at tRNA end position |
aagcttcttc |
Secondary structure (Cloverleaf model) | >WENV170646183 Pro GGG T ATtg aagcttcttc G - C G - C G - C G - C C - G C - G A - T T A T G C C G C A C G A A | | | | | A C T G G G C G G C G C T | | + T T G T C C T G T A A TGAC C - G A - T G - C G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |