Sequence ID | >WENV170646185 |
Genome ID | JQGG01019459 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 529 |
End posion on genome | 605 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
cctcccaagt |
tRNA gene sequence |
CGGAGTGTGGCTCAGTCTGGTAGAGCACCGCGTTCGGGACGCGGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
tcttttcccg |
Secondary structure (Cloverleaf model) | >WENV170646185 Pro CGG t ACCA tcttttcccg C - G G - C G - C A - T G - C T - A G - C T A T C G T C C A T G A G | | | | | G C C T C G G C A G G C T | | | | T T G G A G C G T A A GGGTC C - G C - G G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |