Sequence ID | >WENV170646186 |
Genome ID | JQGG01019459 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 384 |
End posion on genome | 311 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ccgttcctgc |
tRNA gene sequence |
TGGGGAATGGTGTAATGGTAACACTGCGGTTTTTGGTACCGTCATTCTAGGTTCGAGTCC |
Downstream region at tRNA end position |
cttctccccc |
Secondary structure (Cloverleaf model) | >WENV170646186 Gln TTG c GCCA cttctccccc T - A G - C G - C G - C G - C A - T A - T T G T G A T C C A A A G | | | | | G T T G T G C T A G G C G | | | | T T G A C A C T A T CATT G + T C - G G - C G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |