Sequence ID | >WENV170646188 |
Genome ID | JQGG01020724 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 161 |
End posion on genome | 231 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
agccacagag |
tRNA gene sequence |
GCGCCAATGGTGTATCGGTAACATTGAAGCTTCCCAAGCTTTAGCGCCGGGTTCGACTCC |
Downstream region at tRNA end position |
ttttgggaga |
Secondary structure (Cloverleaf model) | >WENV170646188 Gly CCC g Agat ttttgggaga G - C C - G G - C C - G C - G A - T A - T T C T G G C C C A T A G | | | | | G C T G T G C C G G G C G | | | + T T G A C A T T A T AGCG G + T A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |