Sequence ID | >WENV170646190 |
Genome ID | JQGG01023774 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 640 |
End posion on genome | 568 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ctttctctac |
tRNA gene sequence |
GCGTCCTTAGCTCAGTGGTAGAGCATCACCTTGACACGGTGGGGGTCGCTGGTTCGAAAC |
Downstream region at tRNA end position |
tccagccgga |
Secondary structure (Cloverleaf model) | >WENV170646190 Val GAC c ACtc tccagccgga G - C C - G G - C T - A C - G C - G T - A A A T C G A C C A G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A A GGGTC T + G C - G A - T C - G C - G T C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |