Sequence ID | >WENV170646192 |
Genome ID | JQGG01025177 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 185 |
End posion on genome | 97 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aaatattttt |
tRNA gene sequence |
GCTCGAGTGGTGGAATTGGTAGACACGCTGGACTTAAAATCCAGTGGGTAGTAATGCCCG |
Downstream region at tRNA end position |
tgcaccccta |
Secondary structure (Cloverleaf model) | >WENV170646192 Leu TAA t ACCA tgcaccccta G - C C - G T C C C G + T A - T G - C T G T C G C C C A T A A G | | | | | A T G G T G G C G G G C G | | | T T G A C A C T A G G TGGGTAGTAATGCCCGT C - G T - A G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |