Sequence ID | >WENV170646193 |
Genome ID | JQGG01025399 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 62 |
End posion on genome | 135 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aatagtactt |
tRNA gene sequence |
TGTCCGATGGTGTAAAGGTAGCACGAATGGTTTTGGTCCATTCGGTCTAGGTTCGAATCC |
Downstream region at tRNA end position |
aaagcaggtt |
Secondary structure (Cloverleaf model) | >WENV170646193 Gln TTG t ACAA aaagcaggtt T - A G - C T + G C - G C - G G - C A - T T A T G G T C C A A A G | + | | | G A T G T G C T A G G C G + | | | T T G G C A C T A G CGGT A - T A - T T - A G - C G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |