Sequence ID | >WENV170646198 |
Genome ID | JQGG01026513 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 261 |
End posion on genome | 185 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gccaatcttc |
tRNA gene sequence |
CAGAGCGTTCCGCAGAGGCTATACGGGCTTGCCTTGGGAGCAAGTATTCGCAGGTTCGAA |
Downstream region at tRNA end position |
gcttttttgc |
Secondary structure (Cloverleaf model) | >WENV170646198 Pro TGG c ACCA gcttttttgc C - G A - T G - C A - T G - C C - G G - C T A T C G T C C A A G A T | | | | | G G C G C C G C A G G C G | | | T T C A C G G T A T G TATTC C - G T - A T - A G - C C - G C A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |