Sequence ID | >WENV170646199 |
Genome ID | JQGG01026513 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 176 |
End posion on genome | 100 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cagctttttt |
tRNA gene sequence |
GCACACGTAGCCCAATCGGTCGAGGCGCGTGTCTTAGAAACAAGTCGATGAAGGTTCGAA |
Downstream region at tRNA end position |
atttcgagcg |
Secondary structure (Cloverleaf model) | >WENV170646199 Leu TAG t ACCA atttcgagcg G + T C - G A - T C - G A - T C - G G - C T A T C T T C C A T A A A | | | | | G C C C C G G A A G G C G | | | T T G A G G C T C G G TCGAT C - G G A T - A G - C T - A C A T A T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |