Sequence ID | >WENV170646201 |
Genome ID | JQGG01027423 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 104 |
End posion on genome | 180 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
cagcagacgt |
tRNA gene sequence |
GGCGCATTCGTCTAGCGGCCCAGGACACCTCCCTCTCAAGGAGGAGACCACCGGTTCGAA |
Downstream region at tRNA end position |
acaccgcaac |
Secondary structure (Cloverleaf model) | >WENV170646201 Glu CTC t ACCA acaccgcaac G + T G - C C - G G - C C - G A - T T - A T A T T G G C C A C G A C | | | | | G G T C T G A C C G G C G + | | | T T C G G A C C C A A AGACC C - G C - G T - A C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |