Sequence ID | >WENV170646206 |
Genome ID | JQGG01029496 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 79 |
End posion on genome | 153 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gcacggccac |
tRNA gene sequence |
TGGGACGTCGGCAAGCGGTAAGCCACCGGATTTTGGTTCCGGCATTCCCAGGTTCGAATC |
Downstream region at tRNA end position |
tcttactcag |
Secondary structure (Cloverleaf model) | >WENV170646206 Gln TTG c GCCA tcttactcag T - A G - C G - C G - C A G C - G G - C T A T G G T C C A G A C | | | | | G C A C G G C C A G G C G | | | T T G A G C C T A A CATTC C - G C - G G - C G - C A - T T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |