Sequence ID | >WENV170646209 |
Genome ID | JQGG01031383 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 240 |
End posion on genome | 315 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
caattaggaa |
tRNA gene sequence |
GGTATCTTAGCTCAGTTGGTAGAGCAAAGGACTGAAAATCCTTGTGTCCGCGGTTCGATT |
Downstream region at tRNA end position |
aacaaagtta |
Secondary structure (Cloverleaf model) | >WENV170646209 Phe GAA a ACAA aacaaagtta G - C G - C T - A A - T T - A C - G T - A T T T G C G C C A T G A A | | | | | G T C T C G C G C G G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |