Sequence ID | >WENV170646213 |
Genome ID | JQGG01037677 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 212 |
End posion on genome | 137 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gcgggaatat |
tRNA gene sequence |
TCCCTGATAGCTCAGCTGGTAGAGCAGGCGACTGTTAATCGCCGGGTCGTAGGTTCAAGT |
Downstream region at tRNA end position |
ctgggggccg |
Secondary structure (Cloverleaf model) | >WENV170646213 Asn GTT t GCTA ctgggggccg T - A C - G C - G C - G T - A G - C A - T T G T C A T C C A C G A A | | | | | A T C T C G G T A G G C G | | | | T T G G A G C T A A GGGTC G - C G - C C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |