Sequence ID | >WENV170646215 |
Genome ID | JQGG01041869 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 165 |
End posion on genome | 90 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ccttagcaca |
tRNA gene sequence |
GGCTCGGTAGCTCAGTTGGTAGAGCAGTGGATTGAAGATCCTCGTGTCGATGGTTCGATT |
Downstream region at tRNA end position |
gtatttgaaa |
Secondary structure (Cloverleaf model) | >WENV170646215 Phe GAA a ACCA gtatttgaaa G - C G - C C - G T - A C - G G - C G - C T T T C T G C C A T G A A | | + | | G T C T C G G A T G G C G | | | | T T G G A G C T A A GTGTC G - C T T G - C G - C A - T T A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |