Sequence ID | >WENV170646216 |
Genome ID | JQGG01042320 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 69 |
End posion on genome | 158 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
accgcaatac |
tRNA gene sequence |
GGAGAGGTCGCATAGTTCGGCCGAGTGCGCACGATTGGAAATCGTGTATCCCGAAAGGGA |
Downstream region at tRNA end position |
gaaatgaccg |
Secondary structure (Cloverleaf model) | >WENV170646216 Ser GGA c GCCA gaaatgaccg G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T T G A C | | | | | A C T A C G G A G G G C G + | | | T T G G T G C C C G A G TATCCCGAAAGGGATC C - G A - T C - G G - C A - T T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |