Sequence ID | >WENV170646217 |
Genome ID | JQGG01044297 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 172 |
End posion on genome | 260 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tgcgggccgg |
tRNA gene sequence |
GCCCGGGTGGCGGAACTGGCAGACGCAGGGGGCTTAAACCCCCCAGCCCCGCGAGGGGCG |
Downstream region at tRNA end position |
atgtgccacc |
Secondary structure (Cloverleaf model) | >WENV170646217 Leu TAA g ACCC atgtgccacc G - C C - G C - G C - G G - C G - C G - C C A T C A C C C A C A A G | | | | | G T G G C G G T G G G C G | | | T T G A C G C C A G A AGCCCCGCGAGGGGCGT G - C G - C G - C G - C G - C C C T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |