Sequence ID | >WENV170646219 |
Genome ID | JQGG01045370 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 296 |
End posion on genome | 372 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gatgtagcac |
tRNA gene sequence |
GCGCCCGTAGCTCAGCCGGATAGAGTAGTGGCTTCCGAAGCCATTGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170646219 Arg CCG c GCCA nnnnnnnnnn G - C C - G G - C C - G C - G C - G G - C T A T C T C C C A C G A A | + | | | G C C T C G G G G G G C G | | | + T T G G A G T A T A A TGGTC G + T T - A G - C G - C C - G T A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |