Sequence ID | >WENV170646220 |
Genome ID | JQGG01048155 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 190 |
End posion on genome | 114 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cggcaggtat |
tRNA gene sequence |
GGCGCGGTAGCTCAGCTGGTTAGAGCGCATGATTCATAATCCTGAGGTCGGGAGTTCAAG |
Downstream region at tRNA end position |
aggccacctt |
Secondary structure (Cloverleaf model) | >WENV170646220 Met CAT t ACGA aggccacctt G + T G - C C - G G - C C - G G - C G - C T G T C C C T C A C G A A | | | | | A T C T C G G G G A G C G | | | | T T G G A G C T T A G AGGTC C - G A - T T C G - C A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |