Sequence ID | >WENV170646221 |
Genome ID | JQGG01048926 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 160 |
End posion on genome | 236 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
cccaaggcga |
tRNA gene sequence |
CGGGATGTAGCTCAGCCTGGTAGAGCACTACGTTCGGGACGTAGGTGTCGGAGGTTCAAA |
Downstream region at tRNA end position |
ctcgccttcg |
Secondary structure (Cloverleaf model) | >WENV170646221 Pro CGG a ACCA ctcgccttcg C - G G - C G - C G - C A - T T - A G - C T A T T C T C C A C G A A + | | | | A C C T C G G G A G G C T | | | | T T G G A G C G T A A GTGTC C - G T - A A - T C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |