Sequence ID | >WENV170646222 |
Genome ID | JQGG01049226 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 189 |
End posion on genome | 262 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gattcaaaac |
tRNA gene sequence |
GGTCCCGTGGCCGAGTGGCTAGGCAGAGCTCTGCAAAAGCTTCTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
aagttgaacc |
Secondary structure (Cloverleaf model) | >WENV170646222 Cys GCA c TCCA aagttgaacc G - C G - C T - A C - G C - G C - G G - C T A T T C G C C A G A G | | | | | G T G C C G A G C G G C G | | | T T G A G G C C T A CTAC G + T A - T G - C C - G T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |