Sequence ID | >WENV170646225 |
Genome ID | JQGG01052585 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 129 |
End posion on genome | 200 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cgctgtcctc |
tRNA gene sequence |
GCGGGCGTAGTTCAGAGGCAGAACATCAGCTTCCCAAGCTGAGAACGCGGGTTCGATTCC |
Downstream region at tRNA end position |
tgcaaaggtc |
Secondary structure (Cloverleaf model) | >WENV170646225 Gly CCC c TCtc tgcaaaggtc G - C C - G G - C G - C G - C C - G G - C T T T T G C C C A G A A + | | | | G A C T T G G C G G G C G | | | | T T G G A A C C A A GAAC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |