Sequence ID | >WENV170646226 |
Genome ID | JQGG01054706 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 148 |
End posion on genome | 223 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tttttgataT |
tRNA gene sequence |
GCTCCCGTAGCTCAGCCGGATAGAGCAACAGCCTTCTAAGCTGTGGGTCGCACGTTCGAG |
Downstream region at tRNA end position |
tttgaaattt |
Secondary structure (Cloverleaf model) | >WENV170646226 Arg TCT T GAga tttgaaattt G - C C - G T + G C - G C - G C - G G - C T G T C G T G C A C G A A | | | | | G C C T C G G C A C G C G | | | | T T G G A G C A T A A GGGTC A - T C - G A - T G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |