Sequence ID | >WENV170646227 |
Genome ID | JQGG01054750 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 235 |
End posion on genome | 162 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tcggttctta |
tRNA gene sequence |
CGTTCTGTAGCTCAGTTGGTAGAGCGTTCGATTGAAAATCGAGAGGTCCCAGGTTCGATC |
Downstream region at tRNA end position |
atgaccgggc |
Secondary structure (Cloverleaf model) | >WENV170646227 Phe GAA a ACat atgaccgggc C - G G - C T - A T - A C - G T + G G - C C T T G G T C C A T G A A | | | | | G T C T C G C C A G G C G | | | | T T G G A G C T A G AGGTC T + G T - A C - G G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |