Sequence ID | >WENV170646228 |
Genome ID | JQGG01056877 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 159 |
End posion on genome | 76 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atatttaagg |
tRNA gene sequence |
GCATTTATGGCTGAGTGGACGATAGCACGGGACTCATAATCTCGCTCTTAATAGACGTCG |
Downstream region at tRNA end position |
agttagtagt |
Secondary structure (Cloverleaf model) | >WENV170646228 Met CAT g Atta agttagtagt G - C C - G A - T T - A T - A T + G A - T T A T C G A C C A T G A G | | | | | G G G T C G G C T G G C G + | | | T T A T A G C C G A A CTCTTAATAGACGTC C - G G - C G + T G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |