Sequence ID | >WENV170646231 |
Genome ID | JQGG01062971 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 222 |
End posion on genome | 140 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aagtgttatt |
tRNA gene sequence |
GCCCTGGTGGCGGAATTGGCATACGCGGTAGGTTGAGGGCCTATGTCCTTAGGACGTGGA |
Downstream region at tRNA end position |
acgccgggaa |
Secondary structure (Cloverleaf model) | >WENV170646231 Leu GAG t ACag acgccgggaa G - C C - G C - G C - G T - A G - C G - C T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C C A T G GTCCTTAGGACGT G + T T - A A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |