Sequence ID | >WENV170646232 |
Genome ID | JQGG01063299 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 76 |
End posion on genome | 149 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gcagtaccgt |
tRNA gene sequence |
GGCACCTTGGCGGAGTGGTTACGCAGGGGTCTGCAAAACCTCGTACACCGGTTCAATTCC |
Downstream region at tRNA end position |
agattctggg |
Secondary structure (Cloverleaf model) | >WENV170646232 Cys GCA t TCCA agattctggg G - C G - C C - G A - T C - G C - G T - A T T T T G G C C A G A G | | | | | A T G G C G A C C G G C G | | | T T G A C G C T T A GTAC G - C G + T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |