Sequence ID | >WENV170646234 |
Genome ID | JQGG01064142 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 84 |
End posion on genome | 176 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cttttttagc |
tRNA gene sequence |
GGAGAGGTGGGTGAGTGGCTGAAACCAAGCGTTTGCTAAACGCTCGTAGTTCCAAAAGAG |
Downstream region at tRNA end position |
attcgtatcc |
Secondary structure (Cloverleaf model) | >WENV170646234 Ser GCT c GCCA attcgtatcc G - C G - C A - T G - C A - T G - C G + T T A T G G C C C A T G A G | | | | | A G G T G G C C G G G C G | | | T T C A A C C T G A A CGTAGTTCCAAAAGAGCTACC A - T G - C C - G G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |