Sequence ID | >WENV170646235 |
Genome ID | JQGG01064476 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 364 |
End posion on genome | 438 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
agtgaatcag |
tRNA gene sequence |
GGTCCCGTAGTTCAATGGATAGAATAGGAGTTTCCTAAACTCTAGATCCAAGTTCGATTC |
Downstream region at tRNA end position |
accctcgcag |
Secondary structure (Cloverleaf model) | >WENV170646235 Arg CCT g ACAA accctcgcag G - C G - C T - A C - G C A C - G G - C T T T G G T T C A T A A A | | | | | G G C T T G C C A A G C G | | | + T T A G A A T T A A AGAT G + T G - C A - T G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |