Sequence ID | >WENV170646238 |
Genome ID | JQGG01068858 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 136 |
End posion on genome | 212 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
aggacgaatt |
tRNA gene sequence |
CGGAGTGTAGCTCAGCCTGGTAGAGCACTGCGTTCGGGACGCAGGGGTCGCAAGTTCGAA |
Downstream region at tRNA end position |
annnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170646238 Pro CGG t ACCA annnnnnnnn C - G G - C G - C A - T G - C T - A G - C T A T T G T C C A C G A A + | | | G C C T C G G C A A G C T | | | | T T G G A G C G T A A GGGTC C - G T - A G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |