Sequence ID | >WENV170646240 |
Genome ID | JQGG01073696 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 95 |
End posion on genome | 20 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
actgccgcac |
tRNA gene sequence |
GCCCTCTTAGCTCAGGGGATAGAGCACAGGTTTCCTAAACCTGGTGTCGCAGGTTCGAAT |
Downstream region at tRNA end position |
tacatccccg |
Secondary structure (Cloverleaf model) | >WENV170646240 Arg CCT c ACCA tacatccccg G - C C - G C - G C - G T + G C - G T - A T A T C G T C C A G G A A | | | | | G G C T C G G C A G G C G | | | | T T A G A G C T A A GTGTC C - G A - T G - C G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |