Sequence ID | >WENV170646241 |
Genome ID | JQGG01075033 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 157 |
End posion on genome | 74 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tacaatacat |
tRNA gene sequence |
GCCCGTGTGGTGAAATGGTAGACACACCGGACTTAAAATCCGACGCCTCACAGCGTGCCG |
Downstream region at tRNA end position |
atacgggatc |
Secondary structure (Cloverleaf model) | >WENV170646241 Leu TAA t ACCA atacgggatc G - C C - G C - G C - G G - C T - A G - C T A T T G G C C A T A A G + | | | | G G A G T G G C C G G C G | | | T T T A C A C A G A CGCCTCACAGCGT C A C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |