Sequence ID | >WENV170646242 |
Genome ID | JQGG01075175 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 872 |
End posion on genome | 796 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ataacacact |
tRNA gene sequence |
CGGGGCGTAGCACAGCCTGGTAGTGCGCACGGTTTGGGACCGTGAGGCCGCAAGTTCGAA |
Downstream region at tRNA end position |
tcttagctgg |
Secondary structure (Cloverleaf model) | >WENV170646242 Pro TGG t ACCA tcttagctgg C - G G - C G - C G - C G - C C - G G - C T A T C G T T C A C G A A | | | | | G C C A C G G C A A G C T | | | | T T G G T G C G T A G AGGCC C - G A - T C - G G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |