Sequence ID | >WENV170646246 |
Genome ID | JQGG01081446 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 181 |
End posion on genome | 107 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
caaggactgc |
tRNA gene sequence |
TCCCCGATAGCTCAGCGGTAGAGCATTCGACTGTTAATCGAATGGCCGTAGGTTCGAATC |
Downstream region at tRNA end position |
ctttctgcca |
Secondary structure (Cloverleaf model) | >WENV170646246 Asn GTT c GCCA ctttctgcca T - A C - G C - G C - G C - G G - C A - T T A T C A T C C A G A A | | | | | G C C T C G G T A G G C G | | | | T T G G A G C T A A TGGCC T - A T - A C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |