Sequence ID | >WENV170646247 |
Genome ID | JQGG01082053 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 218 |
End posion on genome | 145 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ggtcggagac |
tRNA gene sequence |
GCCCCCATAGCTCAAAGGATAGAGCAGGTGCCTTCTAAGCACAAGGTTGTGAGTTCGATC |
Downstream region at tRNA end position |
tagggcaggc |
Secondary structure (Cloverleaf model) | >WENV170646247 Arg TCT c GCtg tagggcaggc G - C C - G C - G C - G C - G C - G A C C T T C G C T C A A A A A | + | | | G G C T C G G T G A G C G | | | | T T A G A G C T A A AGGTT G A G - C T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |